View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20982_low_11 (Length: 220)
Name: NF20982_low_11
Description: NF20982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20982_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 5e-55; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 1 - 170
Target Start/End: Original strand, 42141453 - 42141625
Alignment:
| Q |
1 |
ataggctacggagaaaaagaaaatgggattgactatttgatttttt----gtttcattttattctcaaatatattttgatgggatagattagatgaattg |
96 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |||||| ||||||||||||||||||| |||||||||||||| |||| ||||||||| |
|
|
| T |
42141453 |
ataggctacggagaaaaagaaaatggg-ttgactatttgttttttttttcttttcattttattctcaaatctattttgatgggatggattggatgaattg |
42141551 |
T |
|
| Q |
97 |
gaatattttgaacgtaaagaattgatgatgatgttgtttttgtctgcaaagtttgataattgatagtgtaactt |
170 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| ||| ||||||||| |
|
|
| T |
42141552 |
gaatattttgaacgcaaagaattgatgatgatgttgtttttgtctacaaagtttgataactgacggtgtaactt |
42141625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 41 - 93
Target Start/End: Original strand, 40885748 - 40885800
Alignment:
| Q |
41 |
ttttttgtttcattttattctcaaatatattttgatgggatagattagatgaa |
93 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||| || |||| ||| ||||||| |
|
|
| T |
40885748 |
ttttatgtttcattttattctcaaatacattttaataggattgatcagatgaa |
40885800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 111 - 166
Target Start/End: Complemental strand, 25520224 - 25520169
Alignment:
| Q |
111 |
taaagaattgatgatgatgttgtttttgtctgcaaagtttgataattgatagtgta |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25520224 |
taaagaattgatgatgatgttgtttttgtctgcaaagtttgataattgatagtgta |
25520169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University