View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20982_low_5 (Length: 394)
Name: NF20982_low_5
Description: NF20982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20982_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 67 - 381
Target Start/End: Original strand, 34686354 - 34686662
Alignment:
| Q |
67 |
attgctcaaaagtacatataaaatttgcatgcctaaactacatttttactaatatggnnnnnnnnnnnnattccatcctcaaatatctcactatatgaaa |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
34686354 |
attgctcaaaagtacatataaaatttgcatgcctaaattacatttttactaatatggtttttgtttt--attccatcctcaaatatctctatatatgaaa |
34686451 |
T |
 |
| Q |
167 |
ttatagatgtaaggatgttatatccctcagattcttttttcattgtcgttttaaagttcaatgcaacatttagtatgtatgaaacaacattttataaata |
266 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
34686452 |
ttatagatgtaaggatgttatatccctct-attcttttttaattgtcgttttaaagttcaatgcaacatt-agtatgtatgaaacaacatttcataaata |
34686549 |
T |
 |
| Q |
267 |
ccaaaacaagcaatatatttgttttatggagtatagtatagtatttaacttattatatatgcattcagagaccaaaatgactatca--catagtatagta |
364 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
34686550 |
ccaaaacaaccaatatatttgttttatggagtatagtatagtatttaacttattatatatgcattcagagaccaaaatgaccatcactcatagtata--- |
34686646 |
T |
 |
| Q |
365 |
tatatctaacttaccct |
381 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
34686647 |
-atatctaacttaccct |
34686662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University