View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20983_high_17 (Length: 443)
Name: NF20983_high_17
Description: NF20983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20983_high_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 8e-99; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 8e-99
Query Start/End: Original strand, 111 - 323
Target Start/End: Original strand, 17638627 - 17638835
Alignment:
| Q |
111 |
gtgtttgaagtctatatattttggtaaataactgatcttataattttgcaatcagaattaatttttagaaacattttagtatccttataatttttgctaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17638627 |
gtgtttgaagtctatatattttggtaaataactgatcttataattttgtaatctgaattaatttttagaaacattttagtatcc--ataatttttgctaa |
17638724 |
T |
|
| Q |
211 |
acccacactactctttagttacttccaacttcgagcataatgaactttcgtctctctttctggtgaattgggggtaaaacactattcttcaaacttagat |
310 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17638725 |
acccac--tactctttagttacttccaacttcgagcataatgaactttcgtctctctttctggtgaattgggggtaaaacactattcttcaaacttagat |
17638822 |
T |
|
| Q |
311 |
tcatccaacggtt |
323 |
Q |
| |
|
||||||||||||| |
|
|
| T |
17638823 |
tcatccaacggtt |
17638835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 347 - 416
Target Start/End: Original strand, 17638836 - 17638906
Alignment:
| Q |
347 |
tatgtctaaatacg-gaaaaccgggaagaccgattcaactaaaccggtgaaacccaactaactcgcattca |
416 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17638836 |
tatgtctaaatatgtgaaaaccgggaagaccgattcaactaaaccggtgaaacccaactaactcgcattca |
17638906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 17638538 - 17638489
Alignment:
| Q |
1 |
ctttatgtaatgcaggaaattcaaattttactactccagaaatgtcattc |
50 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
17638538 |
ctttatgttatgcaggaaattcaaattttactactccaaaaatgacattc |
17638489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 63 - 110
Target Start/End: Original strand, 17001381 - 17001430
Alignment:
| Q |
63 |
cagatgaccca--gaatcttgaaccagactctgctaccattttagaaatc |
110 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
17001381 |
cagatgacccaatgaatcttgaaccagactctgataccattttagaaatc |
17001430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 56 - 113
Target Start/End: Original strand, 28407746 - 28407805
Alignment:
| Q |
56 |
ctgacaacagatgaccca--gaatcttgaaccagactctgctaccattttagaaatcgtg |
113 |
Q |
| |
|
|||||||||| ||||||| ||||| |||||||| ||||| |||||| |||||||||||| |
|
|
| T |
28407746 |
ctgacaacaggtgacccaaagaatcgtgaaccaggctctgataccatcttagaaatcgtg |
28407805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University