View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20983_low_35 (Length: 315)
Name: NF20983_low_35
Description: NF20983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20983_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 8e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 119 - 298
Target Start/End: Original strand, 43544127 - 43544306
Alignment:
| Q |
119 |
ctagtgccagttcaacattttagaagacttaaaacaagaacaaagaaataacataccaaagagtggttcaaaacaaagtcaaaatgatactataagtcca |
218 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43544127 |
ctagtgccagttcaacattttagaaggcttaaaacaagaacaaagaaataacataccaaagagtggttcaaaacaaagtcaaaatgatactataagtcca |
43544226 |
T |
 |
| Q |
219 |
gcagcaggaactttttgcacataaataaaacatgtggataatatacaccagcagcaaataaggggataatatatcacttt |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43544227 |
gcagcaggaactttttgcacataaataaaacatgtggataatatacaccagcagcaaataaggggataatatatcacttt |
43544306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University