View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20983_low_40 (Length: 291)
Name: NF20983_low_40
Description: NF20983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20983_low_40 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 85 - 244
Target Start/End: Original strand, 8530309 - 8530468
Alignment:
| Q |
85 |
gagaaatgcttaatcccacgagagtgatttctaagaaatcaacgaatgacgtgggttacctcaataattgcataaagtctatctctctctcactcnnnnn |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8530309 |
gagaaatgcttaatcccacgagagtgatttctaagaaatcaacgaatgacttgggtaacctcaataattgcataaagtctatctctctctcactctcttt |
8530408 |
T |
|
| Q |
185 |
nnnnaaataaaaataaaaattggttaccaaattaaaaccctggtctgcttcttcttcttc |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
8530409 |
ttttaaataaaaataaaaattggttaccaaattaaaacccttgtcttcttcttcttcttc |
8530468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 232 - 267
Target Start/End: Original strand, 8530465 - 8530500
Alignment:
| Q |
232 |
cttcttcttcttcccatgatcgacacaaatacccgg |
267 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8530465 |
cttcttcttcttcccatgctcgacacaaatacccgg |
8530500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 23983738 - 23983819
Alignment:
| Q |
1 |
atagataaattgttggttcatttctcttttcccctattacctgtttgatgaaatgtttgattctattctatatcattttatttt |
84 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23983738 |
atagataaattgttggttcaattctgttttcccctgttacctgtttgatgaaatgtttgattctattc--tatcattttatttt |
23983819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 189 - 230
Target Start/End: Complemental strand, 5155832 - 5155791
Alignment:
| Q |
189 |
aaataaaaataaaaattggttaccaaattaaaaccctggtct |
230 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
5155832 |
aaataaaaataaaaattggttaccaacgtaaaaccctcgtct |
5155791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University