View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20983_low_50 (Length: 227)

Name: NF20983_low_50
Description: NF20983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20983_low_50
NF20983_low_50
[»] chr5 (1 HSPs)
chr5 (15-201)||(14502951-14503133)


Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 15 - 201
Target Start/End: Complemental strand, 14503133 - 14502951
Alignment:
15 caaaggcaacttaatttaattatctttggtgctctcataattaagccttctcatagagtttaaaactatgtactatatgtatctttattcaaatccacaa 114  Q
    ||||||||||||||||||     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14503133 caaaggcaacttaatttag----ctttggtgctctcataattaagccttctcatagagtttaaaactatgtactatatgtatctttattcaaatccacaa 14503038  T
115 tgtattgctgatttgctggtactaatcattttgattgtagatttaggtaatatacatgtaaaaatagtgaggtctaagtaagttaag 201  Q
    | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14503037 tatattgctgatttgctggtactaatcattttgattgtagatttaggtaatatacatgtaaaaatagtgaggtctaagtaagttaag 14502951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University