View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20983_low_52 (Length: 220)
Name: NF20983_low_52
Description: NF20983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20983_low_52 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 16 - 173
Target Start/End: Complemental strand, 675440 - 675283
Alignment:
| Q |
16 |
ccttgaaccactcatgactcaacagtggtgtcataattgatggttgaaccagatccttgtgttgaacttcttcataacaaggtgctttggtgacgtgtcc |
115 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| || ||||||||| |
|
|
| T |
675440 |
ccttgaaccactcatgactcaatagtggtgtcataattgatggttgaaccagctccttgtgttgaacatcttcataacaaggtgcttaggggacgtgtcc |
675341 |
T |
 |
| Q |
116 |
atttagtatcactaatggccgttcaagtagatataaatgaaaaatgcttctctttgag |
173 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
675340 |
atttagtatcactaatggccgttcaaggagatataaatgaaaaatgcttctctttgag |
675283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University