View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20985_high_29 (Length: 359)
Name: NF20985_high_29
Description: NF20985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20985_high_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 21 - 344
Target Start/End: Complemental strand, 38712951 - 38712632
Alignment:
| Q |
21 |
tgcgcaagctgtaaaattgaagagaaaaggaaaagtgagtaaccgagaataagggcggtgcgaggggcggggcctttgaggttgcgaagagagaagagtg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38712951 |
tgcgcaagctgtaaaattgaagagaaaaggaaaagtgagtaaccgagaataagggcggtgcgaggggcggggcctttgaggttgcgaagagagaagagtg |
38712852 |
T |
 |
| Q |
121 |
ctctgaagcgttcggagattggctgggttgagtccaacagcaattcgcacaggaacttctccatctctgatgagcacgaagcgacgtcgtttagcgaatt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38712851 |
ctctgaagcgttcggagattggctgggttgagtccaacagcaactcgcacaggaacttctccatctctgatgagcacgaagcaacgtcgtttagcgaatt |
38712752 |
T |
 |
| Q |
221 |
cgcagacatagagcgattaacaaaaattgtgagaagagagtgtgggcttatgaagacggtggtgggtctgacggaggcgatcggcgagttcaggtgttag |
320 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38712751 |
cgcagacatagagcgattaac-aaaattgtgagaagagagtgtgggcttatgaagacggtggtgggtctgacggaggcgatcggcgagttcaggtgttag |
38712653 |
T |
 |
| Q |
321 |
aaatatagttagggactcaaaact |
344 |
Q |
| |
|
| |||||||||||||||||||| |
|
|
| T |
38712652 |
a---atagttagggactcaaaact |
38712632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University