View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20985_high_41 (Length: 276)

Name: NF20985_high_41
Description: NF20985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20985_high_41
NF20985_high_41
[»] chr8 (3 HSPs)
chr8 (11-255)||(27066833-27067077)
chr8 (127-255)||(27080633-27080761)
chr8 (114-254)||(27053747-27053887)


Alignment Details
Target: chr8 (Bit Score: 241; Significance: 1e-133; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 11 - 255
Target Start/End: Original strand, 27066833 - 27067077
Alignment:
11 cataggtggtgaaattctctccgaggctgtagaaggtgaaattctggtcagtttcgtagacagtgaaatgtgaggggtcgaaaggacgttgttttgtgag 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27066833 cataggtggtgaaattctctccgaggctgtagaaggtgaaattctggtcagtttcgtagacagtgaaatgtgaggggtcgaaaggacgttgttttgtgag 27066932  T
111 ttccgggaagcagaagagatgggcggcggagcagaactccggcagctttgtggagagtgtgttggcggccgcgtgttttgtgaatgtcgcggcttcggtg 210  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27066933 ttccgggaagcagaagagatgggcggcggagcagaattccggcagctttgtggagagtgtgttggcggccgcgtgttttgtgaatgtcgcggcttcggtg 27067032  T
211 gcgctgagtggtgaggccttagagaggatgaaagatggttttggt 255  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
27067033 gcgctgagtggtgaggccttagagaggatgaaagatggttttggt 27067077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 127 - 255
Target Start/End: Original strand, 27080633 - 27080761
Alignment:
127 agatgggcggcggagcagaactccggcagctttgtggagagtgtgttggcggccgcgtgttttgtgaatgtcgcggcttcggtggcgctgagtggtgagg 226  Q
    |||||||| || |||||||||||||||| ||||||||||||||||||||| ||||||||||| |  || | |||||  |||||||||||||||||||| |    
27080633 agatgggcagccgagcagaactccggcaactttgtggagagtgtgttggctgccgcgtgtttcgcaaaagccgcggtctcggtggcgctgagtggtgatg 27080732  T
227 ccttagagaggatgaaagatggttttggt 255  Q
    |||||  ||||||||| | ||||||||||    
27080733 ccttattgaggatgaatgttggttttggt 27080761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 114 - 254
Target Start/End: Original strand, 27053747 - 27053887
Alignment:
114 cgggaagcagaagagatgggcggcggagcagaactccggcagctttgtggagagtgtgttggcggccgcgtgttttgtgaatgtcgcggcttcggtggcg 213  Q
    |||||||||||||||||| ||||| |||||||| ||||||| ||||||||| | |||||||||||| ||||| |||   || |  || || |||||||||    
27053747 cgggaagcagaagagatgtgcggcagagcagaattccggcaactttgtggataatgtgttggcggcagcgtgcttttcaaaagctgcagcatcggtggcg 27053846  T
214 ctgagtggtgaggccttagagaggatgaaagatggttttgg 254  Q
    || |||||||| ||||| ||||||||||| |||||||||||    
27053847 ctaagtggtgacgccttggagaggatgaaggatggttttgg 27053887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University