View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20985_high_44 (Length: 248)
Name: NF20985_high_44
Description: NF20985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20985_high_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 22 - 240
Target Start/End: Original strand, 4075344 - 4075562
Alignment:
| Q |
22 |
aggctcccattgcttcctatagatagatggatggccttcttttctgtactctgatagctgtgtgatgttaagcaattgaacattcaaacctctagttttc |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| || ||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4075344 |
aggctcccattgcttcctatagatagatggatgaccttcttttctgtactctgagagttgtgttatgttaagcaattgaacattcaaacctcttcttttc |
4075443 |
T |
 |
| Q |
122 |
aaatcttctagaacattttcaaccacttgcatcattttaggaacagaaccatttccactatatccatcttctgtaatttgatctctttctttgtaacaat |
221 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
4075444 |
aaatcttgtagaacattttccaccacttgcatcattttaggaacagaaccatttccactatatccctcttctttaatttgatctctttctttgtaacaat |
4075543 |
T |
 |
| Q |
222 |
tttcaccctttgcttctcc |
240 |
Q |
| |
|
|||||||||||||| |||| |
|
|
| T |
4075544 |
tttcaccctttgctcctcc |
4075562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 26 - 162
Target Start/End: Complemental strand, 25824812 - 25824676
Alignment:
| Q |
26 |
tcccattgcttcctatagatagatggatggccttcttttctgtactctgatagctgtgtgatgttaagcaattgaacattcaaacctctagttttcaaat |
125 |
Q |
| |
|
||||| || |||||||||||||| || || |||||||||||||| ||||| || |||||||||||||||| ||||||||| |||||| | |||||||||| |
|
|
| T |
25824812 |
tcccactgtttcctatagatagaagggtgaccttcttttctgtattctgagagttgtgtgatgttaagcatttgaacatttaaaccttttgttttcaaat |
25824713 |
T |
 |
| Q |
126 |
cttctagaacattttcaaccacttgcatcattttagg |
162 |
Q |
| |
|
| || || || || || |||||||||||||||||||| |
|
|
| T |
25824712 |
catcaagcaccttctccaccacttgcatcattttagg |
25824676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University