View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20985_high_48 (Length: 231)
Name: NF20985_high_48
Description: NF20985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20985_high_48 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 17 - 224
Target Start/End: Original strand, 47580162 - 47580369
Alignment:
| Q |
17 |
cacttattgctatggttttcatctctcaggcaagttaattagtgatttaaaatccattctttttcttaaattctggtactgaatgtgtttattgttttat |
116 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47580162 |
cacttattgttatggttttcatctctcaggcaagttaattagtgatttaaaatccattctatttcttaaattctggtactgaatgtgtttattgttttat |
47580261 |
T |
 |
| Q |
117 |
atgatgctgcagtatcttcattgttatataagcaccaagaagcctacatttgaccgatttgcagttctgttttccattgcaagtgcatggttatttgcac |
216 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
47580262 |
atgatgctgcagtatcttcatcgttatataagcaccaagaagcctacatttgaccgatttgcagttctgtttaccattgcaagtgcatggttatttgcac |
47580361 |
T |
 |
| Q |
217 |
aggttctg |
224 |
Q |
| |
|
|| ||||| |
|
|
| T |
47580362 |
agcttctg |
47580369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University