View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20985_high_51 (Length: 219)
Name: NF20985_high_51
Description: NF20985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20985_high_51 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 15 - 201
Target Start/End: Original strand, 1240135 - 1240321
Alignment:
| Q |
15 |
catagggcataggaaagcaaattttggtgtccaacaccgtatacgtatatggtatagatacaannnnnnnnnnnnnnnnnnnnnnncttggtctccaagt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1240135 |
catagggcataggaaagcaaattttggtgtccaacaccgtatacgtatatggtatagatacaattttgttttttaattagttttttcttggtctccaagt |
1240234 |
T |
 |
| Q |
115 |
cacatccatcgttataaatgtattattatattgtgtcaaattttagatgtttagataacatcactcattgtgaaaatcactctaaac |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1240235 |
cacatccatcgttataaatgtattattatattgtgtcaaattttagatgtttagataacatcactcattgtgaaaatcactctaaac |
1240321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 52; Significance: 5e-21; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 105 - 180
Target Start/End: Original strand, 10175205 - 10175280
Alignment:
| Q |
105 |
gtctccaagtcacatccatcgttataaatgtattattatattgtgtcaaattttagatgtttagataacatcactc |
180 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||| |||||||||||||||| || |||||||||||||| |
|
|
| T |
10175205 |
gtctccaagtcacatccattgttataaatgtatttttatacggtgtcaaattttagatattcagataacatcactc |
10175280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 28 - 77
Target Start/End: Original strand, 10175126 - 10175175
Alignment:
| Q |
28 |
aaagcaaattttggtgtccaacaccgtatacgtatatggtatagatacaa |
77 |
Q |
| |
|
||||||| ||||||||||| ||||| ||||| |||||||||||||||||| |
|
|
| T |
10175126 |
aaagcaatttttggtgtccgacaccatatacatatatggtatagatacaa |
10175175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University