View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20985_high_53 (Length: 209)
Name: NF20985_high_53
Description: NF20985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20985_high_53 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 19 - 193
Target Start/End: Complemental strand, 14811505 - 14811332
Alignment:
| Q |
19 |
acaagggttgtaatggatgatagctttctcattcataagtatgggttgactttgcttcgctctgatgagatcaaaaggccacgttttgatcccgctcgat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
14811505 |
acaagggttgtaatggatgatagctttctcattcataagtatgggttgacttcgcttcgctctgatgagatcaaaaggccacgttttgatcccgctcggt |
14811406 |
T |
 |
| Q |
119 |
tggttggtatctgtttcgtttttgtagtctggtttgctttgtcttactgttcatttacattttatgtagtctctg |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| ||||||||| |
|
|
| T |
14811405 |
tggttggtatctgtttcgtttttgtagtctggtttgctttgtcttactgtttatttaca-tttatttagtctctg |
14811332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University