View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20985_low_33 (Length: 337)
Name: NF20985_low_33
Description: NF20985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20985_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 4e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 109 - 286
Target Start/End: Complemental strand, 7856914 - 7856736
Alignment:
| Q |
109 |
atttcatagtgagtgaaagaaaagaacaaacagtgaataaaaaatttagggttcaatttctcaaaatctctcggtctnnnnnnn-ccccaatattataga |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7856914 |
atttcatagtgagtgaaagaaaagaacaaacagcgaataaaagatttagggttcaatttctcaaaatctctcggtctaaaaaaaaccccaatattataga |
7856815 |
T |
 |
| Q |
208 |
ttttaaaccctaaccagagaagattcaattatttccagcagtcaaataacagattcaaatacaggaaaattatcaatca |
286 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7856814 |
ttttaaaccctaatcagagaagattcaattatttccagcagtcaaataacagattcaaatacaggaaaattatcaatca |
7856736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 75 - 116
Target Start/End: Original strand, 44196246 - 44196287
Alignment:
| Q |
75 |
ttgttaaaatgtggatgtacatgtatcatttctcatttcata |
116 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||| |||||| |
|
|
| T |
44196246 |
ttgttaaaaagtggatgtacatatatcatttctcaattcata |
44196287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University