View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20985_low_38 (Length: 306)
Name: NF20985_low_38
Description: NF20985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20985_low_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 17 - 288
Target Start/End: Complemental strand, 44243421 - 44243150
Alignment:
| Q |
17 |
agttatgtaaagtatgagtgtctttttaacaagtatgagtattgtttattaactactttagtctcaactttcaaataatgtaggattttttggtgtacca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44243421 |
agttatgtaaagtatgagtgtctttttaacaagtatgagtgttgtttattaactactttagtctgaactttcaaataatgtaggattttttggtgtacca |
44243322 |
T |
 |
| Q |
117 |
gaataatggcctaaaaagaggtgtaaaatttcaccatatcgtgttattaggtgaaagagtttattttacccttctagttattttcaagttcaaatgtgct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44243321 |
gaataatggcctaaaaagaggtgtaaaatttcaccatatcgtgttattaggtgaaagagtttattttacccttctagttattttcaagttcaaatgtgct |
44243222 |
T |
 |
| Q |
217 |
ctgattgctgagaagaaaggtagaagtaaaattagagagttcaaaacctaccaagaaaatgacgttgagaat |
288 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44243221 |
ctgattgctgagaagaaaggtaaaagtaaaattagagagttcaaaacctaccaagaaaatgacgttgagaat |
44243150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University