View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20985_low_41 (Length: 293)
Name: NF20985_low_41
Description: NF20985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20985_low_41 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 17 - 274
Target Start/End: Complemental strand, 37219203 - 37218946
Alignment:
| Q |
17 |
ttctccaacattaacaaacacgtaagtagattcaataccatttgtcaaaagatattaaaatttaattatgtcaaatttatgacttgagtttcatctgtca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37219203 |
ttctccaacattaacaaacacgtaagtagattcaataccatttgtcaaaagaaattaaaatttaattatgtcaaatttatgacttgagtttcatctgtca |
37219104 |
T |
|
| Q |
117 |
aatttcagggatgaaactccttttatgaccaatgccacagaatcatatcagccacaatttcaagggtgcaactccaagtgctataaaattgttgaagagg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37219103 |
aatttcagggatgaaactccttttatgaccaatgccacagaatcatatcagccacaatttcaagggtgcaactccaagtgctataaaattgttgaagagg |
37219004 |
T |
|
| Q |
217 |
tttgtatattcttgcaaaaacttttacttaaaatatttgtctgtcgttgatttggaat |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37219003 |
tttgtatattcttgcaaaaacttttacttaaaatatttgtctgtcgttgatttggaat |
37218946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University