View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20985_low_43 (Length: 278)
Name: NF20985_low_43
Description: NF20985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20985_low_43 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 273
Target Start/End: Original strand, 52514745 - 52515017
Alignment:
| Q |
1 |
tccgtccgaactactctgctccggagtttgaagagagtctgcctcagcattcaacatgtcagtatctggttcaggaagtcgctgtcgaagtggcacagca |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52514745 |
tccgtccaaactactctgctccggagtttgaagagagtctgcctcagcattcaacatgtcagtatctggttcaggaagtcgctgtcgaagtggcacagca |
52514844 |
T |
|
| Q |
101 |
tcactgatgacttcatcattcttcagcttctcacggtaatactccatttctgttatgtacctctctttgtccttcacggctttatcttgataaaccttaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52514845 |
tcactgatgacttcatcattcttcagcttctcacggtaatactccatttctgttatgtacctctctttgtccttcacggctttatcttgataaaccttaa |
52514944 |
T |
|
| Q |
201 |
atgttggtgcaacttaacatgttaacataaaaacacaagataaaataaccaaataatgcatatctgtgcttct |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
52514945 |
atgttggtgcaacttaacatgttaacataaaaacacaagataaaataaccaaataatgcatatctgagcttct |
52515017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University