View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20985_low_49 (Length: 242)
Name: NF20985_low_49
Description: NF20985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20985_low_49 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 27964301 - 27964533
Alignment:
| Q |
1 |
taatgctaatacacttgtatcaagagttttcgttgctgttttgcttgttctcttggcttccccattgggaataccgatttatgcatatttcaagggtaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
27964301 |
taatgctaatacacttgtatcaagagttttcgttgctgttttgcttgttcttttggcatcaccattggggataccggtttatgcatatttcaagggtaga |
27964400 |
T |
|
| Q |
101 |
aattcgggtcgggttggtggtgatgtagagggtcaaagggttagagaaccattgcttcaaaatggtgaaaaagaaagtgaaacaacc---------gctc |
191 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27964401 |
aattcgggtcgggatggtggtgatgtagagggtcaaagggttagagaaccattgcttcaaaatggtgaaaaagaaagtgaaacaaccgttaccgatgctc |
27964500 |
T |
|
| Q |
192 |
tcgtggctgagacggaggtggtggtgattaagg |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
27964501 |
tcgtggctgagacggaggtggtggtgattaagg |
27964533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University