View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20985_low_51 (Length: 237)
Name: NF20985_low_51
Description: NF20985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20985_low_51 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 17 - 225
Target Start/End: Complemental strand, 36467903 - 36467695
Alignment:
| Q |
17 |
cacagatccaagtagaaaacgcacacaaccaatccacataaccatacagcagacatccaaatagttacaatgcattcttctttttgcatactaattgacg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36467903 |
cacagatccaagtagaaaacgcacacaaccaatccacataaccatacagcagacatccaaatagttacaatgcattcttctttttgcatactaattgacg |
36467804 |
T |
 |
| Q |
117 |
cataataatgttcccattagaataacgtttcacatcatcctttcttacttcaaacccgtggtattttgcaaacaatacataaaactccgtagcttcatcc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36467803 |
cataataatgttcccattagaataacgtttcacatcatcctttcttacttcaaacccgtggtattttgcaaacaatacataaaactccgtagcttcatcc |
36467704 |
T |
 |
| Q |
217 |
tctgtgttg |
225 |
Q |
| |
|
||||||||| |
|
|
| T |
36467703 |
tctgtgttg |
36467695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University