View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20985_low_58 (Length: 204)
Name: NF20985_low_58
Description: NF20985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20985_low_58 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 19 - 193
Target Start/End: Complemental strand, 39077263 - 39077085
Alignment:
| Q |
19 |
gcattgcatgtcagtgaaaaaattcaatcaatcc-attctaaataatgtctcaaattcatcaat---gctgacacaagtaattaaagatgtgttatgggt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39077263 |
gcattgcatgtcagtgaaaaaattcaatcaatcccattctaaataatgtctcaaattcatcaatattgctgacacaagtaattaaagatgtgttatgggt |
39077164 |
T |
|
| Q |
115 |
cccgtttctatgatcttcatggttacaattaccaatgaagataattcattttcacttccatgccatgtgatgtgtatct |
193 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39077163 |
cccctttctatgatcttcatggttacaattaccaatgaagataattcattttcacttccatgccatgtgatgtgtatct |
39077085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University