View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20986_low_6 (Length: 295)
Name: NF20986_low_6
Description: NF20986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20986_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 13 - 269
Target Start/End: Original strand, 7945181 - 7945437
Alignment:
| Q |
13 |
tgagtatggtgaatcatccaaacctagtgaagcttgttggttattgtgtagaagatgatcaaaggattttagtttatgagtacatgaccaatggaagctt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7945181 |
tgagtatggtgaatcatccaaacctagtgaagcttgttggttattgtgtagaagatgatcaaaggattttagtttacgagtacatgaccaatggaagctt |
7945280 |
T |
|
| Q |
113 |
ggaagatcaccttcttggtaggtagtagtatctaaaaacattatgtttcttagacttcnnnnnnnggtgaataggaaattgcatccttaaaattgtaacc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
7945281 |
ggaagatcaccttcttggtaggtagtagtatctaaaaacattatgtttcttagacttctttttttggtgaataggaaattgcatccttaaaattgcaacc |
7945380 |
T |
|
| Q |
213 |
atcgatcaaagtagcctctcnnnnnnncgaattagcaattgcgtccttgacgtcaat |
269 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7945381 |
atcgatcaaagtagcctctctttttttcgaattagcaattgcgtccttgacgtcaat |
7945437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University