View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20986_low_7 (Length: 250)
Name: NF20986_low_7
Description: NF20986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20986_low_7 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 9 - 250
Target Start/End: Original strand, 7944797 - 7945034
Alignment:
| Q |
9 |
agcagagatagacaaattacaacagaaatactaaaatatggagctgcaaaaaacgatgttaaagtattaacatatgaagaaattgctgaggcaacaaaca |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7944797 |
agcagacatagacaaattacaacagaaatactaaaatatggagctgcaaaaaacgatgttaaagtattaacatatgaagaaattgctgaggcaacaaaca |
7944896 |
T |
|
| Q |
109 |
acttcggttctgattgtcttgtgggagaaggcggatttgggaatgtgtataaaggatacatgaaaagcattgaacaagtttgnnnnnnnnnnnnnnnttc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
7944897 |
acttcggttctgattgtcttgtgggagaaggtggatttgggaatgtgtataaaggatacatgaaaagcattgaacaagtttg----tttctctctctttc |
7944992 |
T |
|
| Q |
209 |
ttgttgtacaagtttgtttcttgttttacaagttatgtgagt |
250 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7944993 |
ttgtagtacaagtttgtttcttgttttacaagttatgtgagt |
7945034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University