View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20986_low_7 (Length: 250)

Name: NF20986_low_7
Description: NF20986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20986_low_7
NF20986_low_7
[»] chr2 (1 HSPs)
chr2 (9-250)||(7944797-7945034)


Alignment Details
Target: chr2 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 9 - 250
Target Start/End: Original strand, 7944797 - 7945034
Alignment:
9 agcagagatagacaaattacaacagaaatactaaaatatggagctgcaaaaaacgatgttaaagtattaacatatgaagaaattgctgaggcaacaaaca 108  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7944797 agcagacatagacaaattacaacagaaatactaaaatatggagctgcaaaaaacgatgttaaagtattaacatatgaagaaattgctgaggcaacaaaca 7944896  T
109 acttcggttctgattgtcttgtgggagaaggcggatttgggaatgtgtataaaggatacatgaaaagcattgaacaagtttgnnnnnnnnnnnnnnnttc 208  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||               |||    
7944897 acttcggttctgattgtcttgtgggagaaggtggatttgggaatgtgtataaaggatacatgaaaagcattgaacaagtttg----tttctctctctttc 7944992  T
209 ttgttgtacaagtttgtttcttgttttacaagttatgtgagt 250  Q
    |||| |||||||||||||||||||||||||||||||||||||    
7944993 ttgtagtacaagtttgtttcttgttttacaagttatgtgagt 7945034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University