View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20988_high_12 (Length: 213)

Name: NF20988_high_12
Description: NF20988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20988_high_12
NF20988_high_12
[»] chr2 (1 HSPs)
chr2 (17-197)||(37513684-37513864)


Alignment Details
Target: chr2 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 17 - 197
Target Start/End: Complemental strand, 37513864 - 37513684
Alignment:
17 tatactttggtatttagttgcagactccaagaaggcagtgttgtgatgtgttggactctaactctggtcaattaatggaaattgcaattagagagtgcaa 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37513864 tatactttggtatttagttgcagactccaagaaggcagtgttgtgatgtgttggactctaactctggtcaattaatggaaattgcaattagagagtgcaa 37513765  T
117 atatgaagaattgatttatatgcattgacagaacaaatgtatatattaaaatctcttgcaatatggttaagcagattcttg 197  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37513764 atatgaagaattgatttatatgcattgacagaacaaatgtatatattaaaatctcttgcaatatggttaagcagattcttg 37513684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University