View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20988_high_8 (Length: 264)
Name: NF20988_high_8
Description: NF20988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20988_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 55 - 252
Target Start/End: Original strand, 1800742 - 1800939
Alignment:
| Q |
55 |
tgtaacatggcatgttaagctaacttggtgtacacatttggtgctaacgatgtcaagagaaaatgtcaaaatgggttatcatttggtgtacacattttgt |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1800742 |
tgtaacatggcatgttaagctaacttggtgtacacatttggtgctaacgatgtcaagagaaaatgtcaaaatgggttatcacttggtgtacacattttgt |
1800841 |
T |
 |
| Q |
155 |
tagattatatttaatatttcgttctgttttgttattgctcaactcaaatcagatgaactatcaaacctctttattttttatcttctttaacccacctt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1800842 |
tagattatatttaatatttcgttctgttttgttattgctcaactcaaatcagatgaactatcaaacctctttattttttatcttctttaacccacctt |
1800939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 61 - 126
Target Start/End: Complemental strand, 25729734 - 25729670
Alignment:
| Q |
61 |
atggcatgttaagctaacttggtgtacacatttggtgctaacgatgtcaagagaaaatgtcaaaat |
126 |
Q |
| |
|
|||| |||||||| |||||||| ||||||||||||||||| | | |||||||||||| ||||||| |
|
|
| T |
25729734 |
atggtatgttaaggtaacttgg-gtacacatttggtgctagtggtctcaagagaaaatatcaaaat |
25729670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University