View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20988_low_10 (Length: 242)
Name: NF20988_low_10
Description: NF20988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20988_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 44958566 - 44958337
Alignment:
| Q |
1 |
gtatcaaatggtccactaacatcttattaaaccacatcaagctttgccctcactggaatacgagaaacaaatgaggtccttgctcgtcaagcaacttaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44958566 |
gtatcaaatggtccactaacatcttattaaaccacatcaagctttgccctcattggaatatgagaaacaaatgagttccttgctcgtcaagcaacttaat |
44958467 |
T |
|
| Q |
101 |
tcgggaaaaccatgcaccatt---gaccttgacttcaaaatgctaagaaccttaaagttaggtgtctatacccaaggtaccacaaccatgttacatcatc |
197 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44958466 |
tcgggaaaaccatgcaccattgacgaccttgacttcaaaatgctaagaaccttaaagttaggtgtctatacccaaggtaccacaaccatgttacatcatc |
44958367 |
T |
|
| Q |
198 |
aattacctcagttgcaaaatagtgaaattt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
44958366 |
aattacctcagttgcaaaatagtgaaattt |
44958337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University