View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20988_low_13 (Length: 213)
Name: NF20988_low_13
Description: NF20988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20988_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 17 - 197
Target Start/End: Complemental strand, 37513864 - 37513684
Alignment:
| Q |
17 |
tatactttggtatttagttgcagactccaagaaggcagtgttgtgatgtgttggactctaactctggtcaattaatggaaattgcaattagagagtgcaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37513864 |
tatactttggtatttagttgcagactccaagaaggcagtgttgtgatgtgttggactctaactctggtcaattaatggaaattgcaattagagagtgcaa |
37513765 |
T |
|
| Q |
117 |
atatgaagaattgatttatatgcattgacagaacaaatgtatatattaaaatctcttgcaatatggttaagcagattcttg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37513764 |
atatgaagaattgatttatatgcattgacagaacaaatgtatatattaaaatctcttgcaatatggttaagcagattcttg |
37513684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University