View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20988_low_8 (Length: 308)
Name: NF20988_low_8
Description: NF20988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20988_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 9e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 19 - 154
Target Start/End: Complemental strand, 502052 - 501917
Alignment:
| Q |
19 |
agcaccgatgcttgaaattttgtcctgcgtcatactcaatatgcaatcgatacgttttggcaaattatcagatgtctgtttttaaaaaacactattttgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
502052 |
agcaccgatgcttgaaattttgtcctgcgtcatactcaatatgccatcgatacgttttggcaaattatcagatgtctgtttttaaaaaacactattttgt |
501953 |
T |
|
| Q |
119 |
tccatttctgcatcagaaatatagattatagcatgc |
154 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||| |
|
|
| T |
501952 |
tccatttctgcatcagaaatatagattttcgcatgc |
501917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 219 - 295
Target Start/End: Complemental strand, 501852 - 501776
Alignment:
| Q |
219 |
gtagtttcacattcttaaatgttgtttcaccttatacacttcaacttctccttttcgggtattgtttagatgggcct |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
501852 |
gtagtttcacattcttaaatgttgtttcaccttatacacttcaacttctccttttcgggtattgtttagatgggcct |
501776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 219 - 295
Target Start/End: Complemental strand, 11788862 - 11788786
Alignment:
| Q |
219 |
gtagtttcacattcttaaatgttgtttcaccttatacacttcaacttctccttttcgggtattgtttagatgggcct |
295 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| | |||||||| ||||||| ||||||||||||| |||||| |
|
|
| T |
11788862 |
gtagtttcacattcttaaatgccatttcaccttataaatttcaactttcccttttcaggtattgtttagacgggcct |
11788786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University