View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20989_high_8 (Length: 207)
Name: NF20989_high_8
Description: NF20989
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20989_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 12 - 190
Target Start/End: Original strand, 39280280 - 39280458
Alignment:
| Q |
12 |
agaagcaaaggatcttttgtacaaaaacatggtaattgccggttttgagcctgatgccttcacgtttaacataatgatcgacgggctttgcaaaaagggg |
111 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39280280 |
agaagccaaggatcttttgtacaaaaacatggtaattgccggttttgagcctgatgccttcacgtttaacataatgatcgatgggctttgcaaaaagggg |
39280379 |
T |
 |
| Q |
112 |
catctggtctcttctcttgaattcttagatgagatggtcaagaaaggttttgaggccaatgtgatcacatacactatat |
190 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39280380 |
tatctggtctctgctcttgaattcttagatgagatggtcaagaaaggttttgagcccaatgtgatcacatacactatat |
39280458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 12 - 190
Target Start/End: Complemental strand, 17350044 - 17349866
Alignment:
| Q |
12 |
agaagcaaaggatcttttgtacaaaaacatggtaattgccggttttgagcctgatgccttcacgtttaacataatgatcgacgggctttgcaaaaagggg |
111 |
Q |
| |
|
|||||| ||||||||| ||||| ||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| || |||||||| |||||| |
|
|
| T |
17350044 |
agaagccaaggatcttctgtaccaaaacatggtaattgccggctttgagcctgatgccttcatgtttaacataatgatcgatggactttgcaagaagggg |
17349945 |
T |
 |
| Q |
112 |
catctggtctcttctcttgaattcttagatgagatggtcaagaaaggttttgaggccaatgtgatcacatacactatat |
190 |
Q |
| |
|
|| |||||||| |||||||||||||| |||||||||| |||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
17349944 |
tatttggtctctgctcttgaattcttaaatgagatggtagagaaaggttttgagccaaatgtgatcacatacactatat |
17349866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University