View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20989_low_9 (Length: 316)
Name: NF20989_low_9
Description: NF20989
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20989_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 14 - 299
Target Start/End: Complemental strand, 8830264 - 8829981
Alignment:
| Q |
14 |
agagctgtgtttaataattgcaattttgttcagtttttattttgacaattttaagttgaaccgatcacctgaactaacccgtaattatcatcaagtttgt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8830264 |
agagctgtgtttaataattgcaattttgttcagtttttattttaacaattttaagttgaaccgatcacctgaactaacccgtaattatcatcaagtttgt |
8830165 |
T |
 |
| Q |
114 |
ttgattcgggtcttctgaccaaatttatcaagaactgaaccaaaccaaacacttttcattcgttgcgannnnnnnnctcgtnnnnnnnnnnncgcatact |
213 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |||| ||| |
|
|
| T |
8830164 |
ttgattcgggtcttctgacaaaatttatcaagaactaaaccaaaccaaacacttttcattcgttgcgattttttttctcgt--aaaaaaaaacgcaaact |
8830067 |
T |
 |
| Q |
214 |
gaaccgatcgttacacctcaattggtagcaggctgcaaatttggtattgaaggaccaaacatataacaaggatgttgttgtcatat |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8830066 |
gaaccgatcgttacacctcaattggtagcaggctgcaaatttggtattgaagggccaaacatataacaaggatgttgttgtcatat |
8829981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University