View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2098_high_14 (Length: 301)
Name: NF2098_high_14
Description: NF2098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2098_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 18 - 295
Target Start/End: Original strand, 45549936 - 45550213
Alignment:
| Q |
18 |
ggtttatgaatgattgcctcttcttcttctgaagattaatggtggattgttttgatgaattcctgggtgtcatttctctccctctgtctttggagataat |
117 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45549936 |
ggtttatgaatgattgcttcttcttcttctgaagattaatggtggattgttttgatgaattcctgggtgtcatttctctccctccgtctttggagataat |
45550035 |
T |
 |
| Q |
118 |
tgacttttgaaccacgatatggtcccgagacttcttttcattgctcatcttaatatgcttgtttgtgattgtttgtccttcctttgcaatttgaatggca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45550036 |
tgacttttgaaccacgatatggtcccgagacttcttttcattgctcatcttaatatgcttgtctgtgattgtttgtccttcttttgcaatttgaatggca |
45550135 |
T |
 |
| Q |
218 |
ggtttaacttgtgatcttctttcgtgcatgttatttagattatgaaatggatcattgccatttatgcttctatccttt |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45550136 |
ggtttaacttgtgatcttctttcgtgcatgttatttagattatgaaatggatcattgccatttatgcttctgtccttt |
45550213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University