View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2098_low_19 (Length: 270)
Name: NF2098_low_19
Description: NF2098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2098_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 82; Significance: 9e-39; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 5 - 103
Target Start/End: Original strand, 32193116 - 32193216
Alignment:
| Q |
5 |
aattcaaaatatcacgcatgtacttttgaaagaattttggggatcgatctattattcatgacgattcatccattgaaatgcatcatata--tgtctcagc |
102 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32193116 |
aatttaaaatatcacgcatgtacttttgaaagaattttgaggatcgatctattattcatgacgattcatccattgaaatgcatcatatacttgtctcagc |
32193215 |
T |
|
| Q |
103 |
a |
103 |
Q |
| |
|
| |
|
|
| T |
32193216 |
a |
32193216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 179 - 233
Target Start/End: Original strand, 32193292 - 32193346
Alignment:
| Q |
179 |
ccgatggaattaaaattccatatcttaaaatgatacgactaaattcttaccacat |
233 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32193292 |
ccgatggaattaaaattctataccttaaaatgatacgactaaattcttaccacat |
32193346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University