View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2098_low_20 (Length: 256)
Name: NF2098_low_20
Description: NF2098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2098_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 119 - 242
Target Start/End: Original strand, 43313604 - 43313726
Alignment:
| Q |
119 |
agattcgttaacaatacccttttattaaatattattgtattgtttcgataatttannnnnnnngtcaaatggtctacaattctctcaagtgtgtaaatcc |
218 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| ||||||||||||| ||||||||| |
|
|
| T |
43313604 |
agattcgttaataatacccttttattaaatattattgtattgtttcgataattt-ttttttttgtcaaatggcctataattctctcaagtatgtaaatcc |
43313702 |
T |
|
| Q |
219 |
ctcacctttaaaacctcatcactc |
242 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
43313703 |
ctcacctttaaaacctcatcactc |
43313726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University