View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2098_low_30 (Length: 237)
Name: NF2098_low_30
Description: NF2098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2098_low_30 |
 |  |
|
| [»] scaffold0008 (3 HSPs) |
 |  |  |
|
| [»] scaffold0251 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0008 (Bit Score: 164; Significance: 9e-88; HSPs: 3)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 20 - 231
Target Start/End: Original strand, 261703 - 261914
Alignment:
| Q |
20 |
atctgaaaatgtggaagagaattcactagatgatgaaaatggggataatggaccattggtgtctgagatttgggagttagctggaggggtaatttggtaa |
119 |
Q |
| |
|
||||||| | |||||||||| ||||||||||||||||||||||||||| || |||||| ||| |||||||||||| || |||||||||||||||||||| |
|
|
| T |
261703 |
atctgaagaggtggaagagatttcactagatgatgaaaatggggataaagggccattgttgtttgagatttgggaactatctggaggggtaatttggtaa |
261802 |
T |
 |
| Q |
120 |
ttcgatatatctctcccttgtgtggattcaattatgtcttttgatttggtggatttagtttcttcatttgtgactatgttatttatagctctcttcttga |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
261803 |
ttcgatatatctctcccttgtgtggattcaattatgtcttttgatttggtggatttagtttcttcatttgtgacaatgttatctatagctctcttcttga |
261902 |
T |
 |
| Q |
220 |
gggaagtgtgcc |
231 |
Q |
| |
|
|||||||||||| |
|
|
| T |
261903 |
gggaagtgtgcc |
261914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008; HSP #2
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 147
Target Start/End: Original strand, 236831 - 236977
Alignment:
| Q |
1 |
ccaaagtagtggaactgggatctgaaaatgtggaagagaattcactagatgatgaaaatggggataatggaccattggtgtctgagatttgggagttagc |
100 |
Q |
| |
|
|||||| ||||||| || |||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
236831 |
ccaaagcagtggaattgtgatctgaagatgtggaagataattcactagatgatgaaaatggggataaagggccattggtgtctgagatttgggagttagc |
236930 |
T |
 |
| Q |
101 |
tggaggggtaatttggtaattcgatatatctctcccttgtgtggatt |
147 |
Q |
| |
|
|||| |||||||||||||||| |||| | ||||||||||||||||| |
|
|
| T |
236931 |
tggaagggtaatttggtaattggatacacatctcccttgtgtggatt |
236977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 168 - 231
Target Start/End: Original strand, 236971 - 237034
Alignment:
| Q |
168 |
gtggatttagtttcttcatttgtgactatgttatttatagctctcttcttgagggaagtgtgcc |
231 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
236971 |
gtggatttggtttcttcatttgtgacaatgttatctatagctctcttcttgagggaagtgtgcc |
237034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 131 - 197
Target Start/End: Complemental strand, 2685211 - 2685145
Alignment:
| Q |
131 |
tctcccttgtgtggattcaattatgtcttttgatttggtggatttagtttcttcatttgtgactatg |
197 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
2685211 |
tctcccttgtgtgaattcaattatgtcctttgatttggtggatttcatttcttggtttgtgactatg |
2685145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 131 - 197
Target Start/End: Original strand, 5478101 - 5478167
Alignment:
| Q |
131 |
tctcccttgtgtggattcaattatgtcttttgatttggtggatttagtttcttcatttgtgactatg |
197 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
5478101 |
tctcccttgtgtgaattcaattatgtcctttgatttggtggatttcatttcttggtttgtgactatg |
5478167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 131 - 197
Target Start/End: Complemental strand, 45008636 - 45008570
Alignment:
| Q |
131 |
tctcccttgtgtggattcaattatgtcttttgatttggtggatttagtttcttcatttgtgactatg |
197 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
45008636 |
tctcccttgtgtgaattcaattatgtcctttgatttggtggatttcatttcttggtttgtgactatg |
45008570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0251 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0251
Description:
Target: scaffold0251; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 33 - 111
Target Start/End: Complemental strand, 10240 - 10162
Alignment:
| Q |
33 |
gaagagaattcactagatgatgaaaatggggataatggaccattggtgtctgagatttgggagttagctggaggggtaa |
111 |
Q |
| |
|
|||||||||||||||||||| |||| |||||| ||||| ||| || | ||| | ||||||| ||||||||||||||| |
|
|
| T |
10240 |
gaagagaattcactagatgaagaaagtggggaaaatgggccagtgatatctagggtttgggaactagctggaggggtaa |
10162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University