View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2098_low_32 (Length: 235)
Name: NF2098_low_32
Description: NF2098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2098_low_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 103 - 220
Target Start/End: Original strand, 48618493 - 48618610
Alignment:
| Q |
103 |
aattctaacaacttactttcacatgattaattatcaagaataatggtcaatagtcatataagtgaaattcctcaactgaagtcatattaaactgagtata |
202 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
48618493 |
aattctaactacttactttcacatgattaatcatcaagaataatggtcaatagtcatataagtgaaattcctcaactgaagtcatattaaactgagttta |
48618592 |
T |
 |
| Q |
203 |
ccctgcttacgcaaattt |
220 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
48618593 |
ccctgcttacgcaaattt |
48618610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 48618420 - 48618494
Alignment:
| Q |
1 |
tgatcataatcaaagccaagaacaagaacgcattaaagatttacattaaaggtgcaaaaaacaaccagaaactaa |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48618420 |
tgatcataatcaaagccaagaacaagaacgcattaaagatttacattaaaggtgcaaaaaacaaccagaaactaa |
48618494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University