View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20990_high_1 (Length: 425)
Name: NF20990_high_1
Description: NF20990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20990_high_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 15 - 176
Target Start/End: Complemental strand, 29814005 - 29813847
Alignment:
| Q |
15 |
acttttctctacaaataatatctaacttttgatagtaaatttttgctgatcaatataaagaaaacatgaatacaaagtttttacatgataataataaccg |
114 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
29814005 |
acttttctctacaaata---tctaacttttgatagtaaatttttgctgatcaatataaagaaaacatgaatacaaagtttttacatgataataataactg |
29813909 |
T |
 |
| Q |
115 |
tatacaaatttacttttaactacgtactttcgttaacatgattgtgcatgcagcatgtgtca |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29813908 |
tatacaaatttacttttaactacgtactttcgttaacatgattgtgcatgcagcatgtgtca |
29813847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 241 - 371
Target Start/End: Complemental strand, 29813781 - 29813651
Alignment:
| Q |
241 |
gttcaggtaggggctgcattctttgtttcgtaacgttgttatctcgttggtcctacggttagtacaaccgtttatttaaccataataacatgaccttaac |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29813781 |
gttcaggtaggggctgcattctttgtttcgtaacgttgttatctcgttggtcctacggttagcacaaccgtttatttaaccataataacatgaccttaac |
29813682 |
T |
 |
| Q |
341 |
cgtcttgtgtacattttatattgaccattgc |
371 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
29813681 |
cgtcttgtgtacattttatattgaccattgc |
29813651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University