View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20993_low_3 (Length: 320)
Name: NF20993_low_3
Description: NF20993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20993_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 6e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 119 - 279
Target Start/End: Complemental strand, 38900720 - 38900560
Alignment:
| Q |
119 |
cgtacaacctctcctttatccttttaactatttgtttatccaaatttattcctccaattagtcaatagcttcactctctaaattgttttaagttttgaca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38900720 |
cgtacaacctctcctttatccttttaactatttgtttatccaaattcattcctccaattagtcaatagctccactctctaaattgttttaagttttgaca |
38900621 |
T |
|
| Q |
219 |
taataagaatgtctttataagcattcacaataataatgaccgatgcacgagaatgtctcaa |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
38900620 |
taataagaatgtctttataagcattcacaataataatgacggataaacgagaatgtctcaa |
38900560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University