View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20993_low_4 (Length: 306)
Name: NF20993_low_4
Description: NF20993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20993_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 257; Significance: 1e-143; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 11 - 291
Target Start/End: Original strand, 1178459 - 1178739
Alignment:
| Q |
11 |
cagaacctgtggaccaaaatttacaacattgggccagttccgtggacatgttgcataagtgatttctggaaggatggcgatcaagtctttggaggaaagg |
110 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1178459 |
cagaaccggtggaccaaaatttacaacattgggccagttccgtggacatgttgcataagtgatttctggaaggatggcgatcaagtctttggaggaaagg |
1178558 |
T |
|
| Q |
111 |
ttggaaagctgctggcttcatatgacgatcaaggcaactcgctaagcgattttcaaatttatgtttcgatttactatagatgtttatggggttctgagta |
210 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
1178559 |
ttggaaagttgctggcatcatatgacgatcaaggcaactcgctcagcgattttcaaatttatgttttgaattactatagatgtttatggggttctgagta |
1178658 |
T |
|
| Q |
211 |
tttacagagcataactcccttgtcaacctagctcaccgcactaggatatttttatttctttctttctgttagtaagtatac |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1178659 |
tttacagagcataactcccttgtcaacctagctcaccgcactaggatatttttatttctttctttctgttagtaagtatac |
1178739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 32 - 243
Target Start/End: Complemental strand, 6840417 - 6840208
Alignment:
| Q |
32 |
tacaacattgggccagttccgtggacatgttgcataagtgatttctggaaggatggcgatcaagtctttggaggaaaggttggaaagctgctggcttcat |
131 |
Q |
| |
|
||||||||||| || ||| |||||| ||||||| | ||| ||| |||||||||||||||| ||| |||||||||||||||||| |||||||| |||| | |
|
|
| T |
6840417 |
tacaacattggaccggttgagtggacttgttgcagacgtggtttttggaaggatggcgatcgagtttttggaggaaaggttggacagctgctgacttcgt |
6840318 |
T |
|
| Q |
132 |
atgacgatcaaggcaactcgctaagcgattttcaaatttatgtttcgatttactatagatgtttatggggttctgagtatttacagagcataactccctt |
231 |
Q |
| |
|
|||| |||||||| ||| || ||||| | ||||| || | || || || |||||||||||| |||| ||||||||| ||||||||||||||||| |
|
|
| T |
6840317 |
atgaagatcaaggaaacctgcatagcgaatctcaaacttctatt--gaagtatgatagatgtttattgggtcatgagtatttgcagagcataactccctt |
6840220 |
T |
|
| Q |
232 |
gtcaacctagct |
243 |
Q |
| |
|
|||||||||||| |
|
|
| T |
6840219 |
gtcaacctagct |
6840208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University