View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20995_high_10 (Length: 293)
Name: NF20995_high_10
Description: NF20995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20995_high_10 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 11 - 293
Target Start/End: Original strand, 8944200 - 8944479
Alignment:
| Q |
11 |
cagatgggagtggatcatgaactggagacaacctttgttctcgtgaaagggatcactattagtgcttgagtcagaggctgtcattgcagggatcactatt |
110 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8944200 |
cagatgggagtggagcatgaactggagacaacctttgttctcgtgaaagggatcactattattgcttgagtcagaggctgtcattgcagggatcactatt |
8944299 |
T |
|
| Q |
111 |
agtgcagattttttggacaaattgatttggagacacgactccgtggctaggtacattgtaaagtcagcatatatactttgtcaaagaaaaaggtgcatca |
210 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8944300 |
agtgcagatttttcggacaaattgatttggagacacgactccgtggctaggtacactgtaaagtcagcatatatactttgtcaaagaaaaaggtgcatca |
8944399 |
T |
|
| Q |
211 |
tgctttgtatataatatttgatcagctcagcagtactaatgagtaaaccatcaaattggcttatgattttgtgaagttctttt |
293 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| | |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8944400 |
tgctttgtatataatgtttgatcagctcagcagtg---acgagtaaaccatcaaattggcctatgattttgtgaagttctttt |
8944479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 57; Significance: 8e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 83 - 187
Target Start/End: Complemental strand, 43564510 - 43564406
Alignment:
| Q |
83 |
agaggctgtcattgcagggatcactattagtgcagattttttggacaaattgatttggagacacgactccgtggctaggtacattgtaaagtcagcatat |
182 |
Q |
| |
|
||||||||| ||||||||||||||| | ||||||||||||| |||||||| | ||| |||||| |||||||||||| |||||| |||||||| |||||| |
|
|
| T |
43564510 |
agaggctgttattgcagggatcactgtgagtgcagatttttcggacaaatgggtttagagacatgactccgtggctgggtacacggtaaagtctgcatat |
43564411 |
T |
|
| Q |
183 |
atact |
187 |
Q |
| |
|
||||| |
|
|
| T |
43564410 |
atact |
43564406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University