View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20995_high_5 (Length: 445)
Name: NF20995_high_5
Description: NF20995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20995_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 76; Significance: 6e-35; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 38 - 113
Target Start/End: Original strand, 22062275 - 22062350
Alignment:
| Q |
38 |
gcccgtgtaacatgcgaagtctaaaagatgtgcatgtaaaaaaggtgcagtatccaacgcaattctggagcaaaat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22062275 |
gcccgtgtaacatgcgaagtctaaaagatgtgcatgtaaaaaaggtgcagtatccaacgcaattctggagcaaaat |
22062350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 166 - 251
Target Start/End: Original strand, 22062345 - 22062430
Alignment:
| Q |
166 |
caaaatcaaacaaaattttgggaacatgatcttggaactctaaaaccctggaaattgggggaaaatagtgcaaattcaatgaacta |
251 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
22062345 |
caaaatcaaacaaaaatttggaaacatgatcttggaactctaaaaccctggaaattagggggaaatagtgcaaattcaatgaacta |
22062430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 5 - 46
Target Start/End: Original strand, 22061288 - 22061329
Alignment:
| Q |
5 |
aatctaagactactgtttttgtttgtttaacttgcccgtgta |
46 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
22061288 |
aatctaggactattgtttttgtttgtttaacttgcccgtgta |
22061329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University