View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20995_low_5 (Length: 445)

Name: NF20995_low_5
Description: NF20995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20995_low_5
NF20995_low_5
[»] chr4 (3 HSPs)
chr4 (38-113)||(22062275-22062350)
chr4 (166-251)||(22062345-22062430)
chr4 (5-46)||(22061288-22061329)


Alignment Details
Target: chr4 (Bit Score: 76; Significance: 6e-35; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 38 - 113
Target Start/End: Original strand, 22062275 - 22062350
Alignment:
38 gcccgtgtaacatgcgaagtctaaaagatgtgcatgtaaaaaaggtgcagtatccaacgcaattctggagcaaaat 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22062275 gcccgtgtaacatgcgaagtctaaaagatgtgcatgtaaaaaaggtgcagtatccaacgcaattctggagcaaaat 22062350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 166 - 251
Target Start/End: Original strand, 22062345 - 22062430
Alignment:
166 caaaatcaaacaaaattttgggaacatgatcttggaactctaaaaccctggaaattgggggaaaatagtgcaaattcaatgaacta 251  Q
    ||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||    
22062345 caaaatcaaacaaaaatttggaaacatgatcttggaactctaaaaccctggaaattagggggaaatagtgcaaattcaatgaacta 22062430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 5 - 46
Target Start/End: Original strand, 22061288 - 22061329
Alignment:
5 aatctaagactactgtttttgtttgtttaacttgcccgtgta 46  Q
    |||||| ||||| |||||||||||||||||||||||||||||    
22061288 aatctaggactattgtttttgtttgtttaacttgcccgtgta 22061329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University