View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20996_high_2 (Length: 552)
Name: NF20996_high_2
Description: NF20996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20996_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 1e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 1e-67
Query Start/End: Original strand, 165 - 299
Target Start/End: Complemental strand, 25538351 - 25538217
Alignment:
| Q |
165 |
aaataatttagctaattatttttcttaaataatagacattattctatttggtgaaatcacgtagaaaaaataaactatttggtctatgagagataaaata |
264 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25538351 |
aaataatttagctaattttttttcttaaataatagacattattctatttggtgaaatcacgtagaaaaaataaactatttggtctatgagagataaaata |
25538252 |
T |
 |
| Q |
265 |
tattgaattgatccttcaaaatcttaaatgcagat |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
25538251 |
tattgaattgatccttcaaaatcttaaatgcagat |
25538217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 435 - 492
Target Start/End: Original strand, 17183009 - 17183066
Alignment:
| Q |
435 |
tttactcaaagaacattttagacctttacacttgttttaatttataataggagtaaat |
492 |
Q |
| |
|
|||||||||||||||||||||| || ||| || |||| ||||||||| ||||| |||| |
|
|
| T |
17183009 |
tttactcaaagaacattttagatctctactctagtttaaatttataaaaggagaaaat |
17183066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 59 - 91
Target Start/End: Complemental strand, 41349690 - 41349658
Alignment:
| Q |
59 |
atggatgacattgtatccaacgaggtatatata |
91 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
41349690 |
atggatgatattgtatccaacgaggtatatata |
41349658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University