View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20997_high_1 (Length: 783)

Name: NF20997_high_1
Description: NF20997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20997_high_1
NF20997_high_1
[»] chr3 (1 HSPs)
chr3 (42-85)||(8842789-8842832)


Alignment Details
Target: chr3 (Bit Score: 44; Significance: 0.000000000000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 42 - 85
Target Start/End: Complemental strand, 8842832 - 8842789
Alignment:
42 gaaggtaatgagccactttaagaaagggatgaaaatacatacaa 85  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
8842832 gaaggtaatgagccactttaagaaagggatgaaaatacatacaa 8842789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University