View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20997_high_1 (Length: 783)
Name: NF20997_high_1
Description: NF20997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20997_high_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 44; Significance: 0.000000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 42 - 85
Target Start/End: Complemental strand, 8842832 - 8842789
Alignment:
| Q |
42 |
gaaggtaatgagccactttaagaaagggatgaaaatacatacaa |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8842832 |
gaaggtaatgagccactttaagaaagggatgaaaatacatacaa |
8842789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University