View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20997_high_9 (Length: 218)
Name: NF20997_high_9
Description: NF20997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20997_high_9 |
 |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 18 - 128
Target Start/End: Complemental strand, 14223114 - 14223004
Alignment:
| Q |
18 |
gacacttctgatcaaatacgttttcggcgtccgacatgacacatacacgacaaatattctcaaaatattattggtgtcgacatgtcagtgtcgtgtccgg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| || |
|
|
| T |
14223114 |
gacacttctgatcaaatacgttttcggcgtctgacatgacacatacacgacacatattctcaaaatattattggtgtcgacatatcagtgtcgtgtcagg |
14223015 |
T |
 |
| Q |
118 |
tgttgcatttc |
128 |
Q |
| |
|
||||||||||| |
|
|
| T |
14223014 |
tgttgcatttc |
14223004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 74 - 114
Target Start/End: Complemental strand, 11815850 - 11815810
Alignment:
| Q |
74 |
ttctcaaaatattattggtgtcgacatgtcagtgtcgtgtc |
114 |
Q |
| |
|
|||||||| ||||||||||||| || ||||||||||||||| |
|
|
| T |
11815850 |
ttctcaaattattattggtgtcaacgtgtcagtgtcgtgtc |
11815810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 46 - 128
Target Start/End: Original strand, 16151808 - 16151890
Alignment:
| Q |
46 |
gtccgacatgacacatacacgacaaatattctcaaaatattattggtgtcgacatgtcagtgtcgtgtccggtgttgcatttc |
128 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
16151808 |
gtccgacatgacacatacacgacacatattctcaaaatattattggtgtcgacatatcagtgtcgtgtccggtgttgcatttc |
16151890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 85 - 128
Target Start/End: Original strand, 16152731 - 16152774
Alignment:
| Q |
85 |
ttattggtgtcgacatgtcagtgtcgtgtccggtgttgcatttc |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
16152731 |
ttattggtgtcgacatgtcagtgtcgtgtccgatgttgcatttc |
16152774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 79 - 115
Target Start/End: Complemental strand, 18638580 - 18638544
Alignment:
| Q |
79 |
aaaatattattggtgtcgacatgtcagtgtcgtgtcc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18638580 |
aaaatattattggtgtcgacatgtcagtgtcgtgtcc |
18638544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 74 - 120
Target Start/End: Original strand, 42205873 - 42205919
Alignment:
| Q |
74 |
ttctcaaaatattattggtgtcgacatgtcagtgtcgtgtccggtgt |
120 |
Q |
| |
|
|||||||| |||||||||||| | ||||||| ||||||||||||||| |
|
|
| T |
42205873 |
ttctcaaattattattggtgttggcatgtcaatgtcgtgtccggtgt |
42205919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 71 - 120
Target Start/End: Original strand, 9878067 - 9878116
Alignment:
| Q |
71 |
atattctcaaaatattattggtgtcgacatgtcagtgtcgtgtccggtgt |
120 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||| ||| |||||| |
|
|
| T |
9878067 |
atattctcaaattattattggtgtcgacgtgtcagtgtcttgttcggtgt |
9878116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 71 - 120
Target Start/End: Original strand, 9897917 - 9897966
Alignment:
| Q |
71 |
atattctcaaaatattattggtgtcgacatgtcagtgtcgtgtccggtgt |
120 |
Q |
| |
|
||||||||||| ||||||||||||||| ||| |||| |||||||||||| |
|
|
| T |
9897917 |
atattctcaaattattattggtgtcgatgtgtgagtgccgtgtccggtgt |
9897966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 74 - 120
Target Start/End: Original strand, 18146 - 18192
Alignment:
| Q |
74 |
ttctcaaaatattattggtgtcgacatgtcagtgtcgtgtccggtgt |
120 |
Q |
| |
|
|||||||||| |||| ||||||||| ||||||||||||||| ||||| |
|
|
| T |
18146 |
ttctcaaaattttatcggtgtcgacgtgtcagtgtcgtgtctggtgt |
18192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 83 - 121
Target Start/End: Complemental strand, 10341068 - 10341030
Alignment:
| Q |
83 |
tattattggtgtcgacatgtcagtgtcgtgtccggtgtt |
121 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
10341068 |
tattactggtgtcgacatgtcagtgtcatgtccggtgtt |
10341030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University