View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20997_low_13 (Length: 256)
Name: NF20997_low_13
Description: NF20997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20997_low_13 |
 |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0011 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 240547 - 240796
Alignment:
| Q |
1 |
tataaaaattaaatccattttactttgctttcaaatttaggtgttacactcttatcggcttcacacatggaatttgctgtattgttctattttatgtctc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
240547 |
tataaaaattaaatccattttactttgctttcacatttaggtgttacactcttatcggcttcacacatggaatttgctgtattgttctattttatgtctc |
240646 |
T |
 |
| Q |
101 |
tatttaactaaggtgctaaaattttaccaaaactgagactcggaagattgcaatatgagcaaagtgcaagtcgtattctatattggtaaagtgtctcaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
240647 |
tatttaactaaggtgctaaaattttaccaaaactgagactcggaagattgcaatatgagcaaagtgcaagtcgtattctatattggtaaagtgtctcaca |
240746 |
T |
 |
| Q |
201 |
agtcagctatcccatgtgaaataaatcatccaacaccccatattcttcga |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
240747 |
agtcagctatcccatgtgaaataaatcatccaacaccccatatttttcga |
240796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University