View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20998_high_5 (Length: 333)
Name: NF20998_high_5
Description: NF20998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20998_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 53 - 281
Target Start/End: Complemental strand, 40079280 - 40079052
Alignment:
| Q |
53 |
ataacaaacacatgcatatttttataacgaaatgcgtgaaaaattggtaacggtatgcacataaagtgggagttatagcacctatatagaatagaacnnn |
152 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
40079280 |
ataacaaacacatgcatatttttattacgaaatgcgtgaaaaattggtaacggtatgcacataaaatgggagttaaagcacctatatagaatagaacaaa |
40079181 |
T |
|
| Q |
153 |
nnnncttaaataactgataaataattgttatgttacaattagacatgtattttgtcaatcttttgttatattcttgcccaacaatgaaaagttggttttt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
40079180 |
aaaacttaaataactgataaataattgttatgttacaattagacatgtattttgtcaatcttttgttatattcttgcccaacaatgaaaagttggtttct |
40079081 |
T |
|
| Q |
253 |
tcttcttcaaaataacatgattaaacatg |
281 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40079080 |
tcttcttcaaaataacatgattaaacatg |
40079052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 292 - 328
Target Start/End: Complemental strand, 40079032 - 40078996
Alignment:
| Q |
292 |
cacaaaaatatgtggtatattattggcctttgcttct |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40079032 |
cacaaaaatatgtggtatattattggcctttggttct |
40078996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University