View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20998_low_5 (Length: 352)
Name: NF20998_low_5
Description: NF20998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20998_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 325; Significance: 0; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 18 - 342
Target Start/End: Complemental strand, 47192262 - 47191938
Alignment:
| Q |
18 |
gttgtcgaaataaaacttatagaaacctgaggaatagtttgtttcacttttggatgaaactaaggttgctcgctcattaatttcttggccaggaagaaga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47192262 |
gttgtcgaaataaaacttatagaaacctgaggaatagtttgtttcacttttggatgaaactaaggttgctcgctcattaatttcttggccaggaagaaga |
47192163 |
T |
|
| Q |
118 |
gtatctgttggaaaatcaaagctttgccaaaggatactaatgttaccgttggtcgtggagagaacgaggttgccattgttttgaagcttgagctgtaatg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47192162 |
gtatctgttggaaaatcaaagctttgccaaaggatactaatgttaccgttggtcgtggagagaacgaggttgccattgttttgaagcttgagctgtaatg |
47192063 |
T |
|
| Q |
218 |
gaaaaggagaaaaggatgaagtggaccaaattggtgttctttttctgtctgcatcggttaaaatgagattaccgtttttgaaaagtgagagttttgagtg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47192062 |
gaaaaggagaaaaggatgaagtggaccaaattggtgttctttttctgtctgcatcggttaaaatgagattaccgtttttgaaaagtgagagttttgagtg |
47191963 |
T |
|
| Q |
318 |
tttgccgttaacaggttggtctctg |
342 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
47191962 |
tttgccgttaacaggttggtctctg |
47191938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 107 - 146
Target Start/End: Complemental strand, 26693303 - 26693264
Alignment:
| Q |
107 |
caggaagaagagtatctgttggaaaatcaaagctttgcca |
146 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
26693303 |
caggaaggagggtatctgttggaaaatcaaagctttgcca |
26693264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 266 - 338
Target Start/End: Original strand, 26745712 - 26745784
Alignment:
| Q |
266 |
ctgcatcggttaaaatgagattaccgtttttgaaaagtgagagttttgagtgtttgccgttaacaggttggtc |
338 |
Q |
| |
|
|||| |||||||||||||| || || |||||| ||| || ||| ||||| |||| ||||||||||||||||| |
|
|
| T |
26745712 |
ctgcgtcggttaaaatgaggttgccagttttgagaagggaaagtgttgagcgttttccgttaacaggttggtc |
26745784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University