View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20998_low_8 (Length: 239)
Name: NF20998_low_8
Description: NF20998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20998_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 168
Target Start/End: Original strand, 14948838 - 14948998
Alignment:
| Q |
1 |
tccacttaggtcccctccaagtaaacttagtccctgttgtagtaacctccatcaaactacggtcatgtcattgattcgattgttaaaattctgacatttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||| |||||||| ||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
14948838 |
tccacttaggtcccctccaagtaaacttagtcc-tgctgtagtaacttccatcaacctacggtgat-----tgattcgattgttaaaattctgacatttt |
14948931 |
T |
|
| Q |
101 |
ctaatgtccacctgcactcctccttttttctcatttggatttgaaatctcattgaaatcacccatcat |
168 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
14948932 |
ctaatgtccacctgcactcctcc-tttttctcatttggatttgcaatcttattgaaatcacccatcat |
14948998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 167 - 221
Target Start/End: Original strand, 14949029 - 14949083
Alignment:
| Q |
167 |
atggtgaagcttttgccatgtttcgttcctctcgtgctccccagaactcgcataa |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
14949029 |
atggtgaagcttttgccatgtttcgttcctctcgtgctcccgaggactcgcataa |
14949083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University