View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20999_high_1 (Length: 490)
Name: NF20999_high_1
Description: NF20999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20999_high_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 8e-53; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 8e-53
Query Start/End: Original strand, 358 - 484
Target Start/End: Original strand, 34306697 - 34306819
Alignment:
| Q |
358 |
agtaatgatggagtttgatcctttcactcgtgcgtgccatatatgtactgaaagaagacacactctgtgattttactatcaaaatctatgcatgcaacat |
457 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34306697 |
agtaatgatggagtttgatcctttcactcgtg----ccatatatgtactgaaagaagacacactatgtgattttactatcaaaatctatgcatgcaacat |
34306792 |
T |
 |
| Q |
458 |
gtcattcactttgatacttctgtgctg |
484 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
34306793 |
gtcattcactttgatacttctgtgctg |
34306819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 17 - 76
Target Start/End: Original strand, 34306208 - 34306267
Alignment:
| Q |
17 |
atctttatttttgtagcagtcttattttttctctcttagtttgtttgcttcacatagata |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34306208 |
atctttatttttgtagcagtcttattttttctctcttagtttgtttgcttcacatagata |
34306267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University