View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20999_high_5 (Length: 235)
Name: NF20999_high_5
Description: NF20999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20999_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 219
Target Start/End: Original strand, 77772 - 77973
Alignment:
| Q |
18 |
tttggtagatattggtggtggcgaagtagtgaaggatgaagttgctcgtgaactagggtttgagaaagtatcagaagaattcattccagaatgcaaatca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
77772 |
tttggtagatattggtggtggcgaagtagtgaaggatgaagttgcgcgtgaactagggtttgagaaagtatcagaagaattcattccagaatgcaaatca |
77871 |
T |
 |
| Q |
118 |
aaagcagtacttttcaaacacgtcaagacgggtgcacaagtcatctctgtttcaaacaaagatgagaacaaagtctttggcattgttttccgaactcctc |
217 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
77872 |
atagcagtacttttcaaacacgtcaagacgggtgcacaagtcatctctgtttcaaacaaagatgagaacaaagtctttggcattgttttccgaactcctc |
77971 |
T |
 |
| Q |
218 |
cc |
219 |
Q |
| |
|
|| |
|
|
| T |
77972 |
cc |
77973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University