View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20999_low_3 (Length: 292)
Name: NF20999_low_3
Description: NF20999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20999_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 93; Significance: 3e-45; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 178 - 278
Target Start/End: Complemental strand, 7136286 - 7136186
Alignment:
| Q |
178 |
gaagttgtgaaatataaaatatactaacttaaaacaaaatttcttggcgtagttaccccataattgtgaatagcttcccccttgagactaaggatgtttt |
277 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7136286 |
gaagttatgaaatataaaatatactaacttaaaacaaaatttcttggcgtagttaccccataattgtgaatagcttcccccttgagactaaggacgtttt |
7136187 |
T |
|
| Q |
278 |
t |
278 |
Q |
| |
|
| |
|
|
| T |
7136186 |
t |
7136186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 28 - 112
Target Start/End: Complemental strand, 7136481 - 7136394
Alignment:
| Q |
28 |
gaactcaccttcaactatttg---aatcctaccaactatcaccaattatttagcaacaacatatatgttgtaatttttaagttactat |
112 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7136481 |
gaactcaccttcaactatttgttgaatcctaccaactctcaccaattatttagcaacaacatatatgttgtaatttttaagttactat |
7136394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University